Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Cellvibrio japonicus Ueda107

Properties
Regulator type: Transcription factor
TF locus tag: CJA_1465
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 11
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 41 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 6
Sequence: ATACTTGACTGCATTACTTGGTTTT
Locus tag: CJA_2843
Name: ydhD
Funciton: Probable monothiol glutaredoxin ydhD
ydhD
Probable monothiol glutaredoxin ydhD

Position: -76
Score: 6
Sequence: ATAGTTGACTGTTTTGCTGGGGTAA
Locus tag: CJA_0888
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Position: -66
Score: 5.6
Sequence: ATACCCGAGTATTTTAATCAGGTAT
Locus tag: CJA_2541
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA
NfuA Fe-S protein maturation

Position: -131
Score: 6.1
Sequence: ATAGTTGAGTAAAATACTCGGGTTT
Locus tag: CJA_1465
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: CJA_1466
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: CJA_1467
Name: sufB
Funciton: Iron-sulfur cluster assembly protein SufB
Locus tag: CJA_1468
Name: sufC
Funciton: Iron-sulfur cluster assembly ATPase protein SufC
Locus tag: CJA_1469
Name: sufD
Funciton: Iron-sulfur cluster assembly protein SufD
Locus tag: CJA_1470
Name: sufS
Funciton: Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
Locus tag: CJA_1471
Name: sufA
Funciton: Iron binding protein SufA for iron-sulfur cluster assembly
Locus tag: CJA_1472
Name: sufT
Funciton: Iron sulfur cluster assembly protein SufT
iscR
Iron-sulfur cluster regulator IscR
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
sufB
Iron-sulfur cluster assembly protein SufB
sufC
Iron-sulfur cluster assembly ATPase protein SufC
sufD
Iron-sulfur cluster assembly protein SufD
sufS
Cysteine desulfurase (EC 2.8.1.7), SufS subfamily
sufA
Iron binding protein SufA for iron-sulfur cluster assembly
sufT
Iron sulfur cluster assembly protein SufT
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD