Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type: Transcription factor
TF locus tag: ASA_2613
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 9
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -70
Score: 7.4
Sequence: ATACTTGACTGTTTTAGTCGGGTAT
Locus tag: ASA_2613
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: ASA_2612
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: ASA_2611
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: ASA_2610
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: ASA_2609
Name: ASA_2609
Funciton: Hypothetical protein
Locus tag: ASA_2608
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: ASA_2607
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: ASA_2606
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR
Iron-sulfur cluster regulator IscR
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
Iron binding protein IscA for iron-sulfur cluster assembly
ASA_2609
Hypothetical protein
hscB
Chaperone protein HscB
hscA
Chaperone protein HscA
fdx
ferredoxin, 2Fe-2S type, ISC system

Position: -78
Score: 6.9
Sequence: ATACTTGAACTAAACAGTCGGGTAT
Locus tag: ASA_0800
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD