Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Psychromonas ingrahamii 37

Properties
Regulator type: Transcription factor
TF locus tag: Ping_1323
Regulator family: Rrf2
Regulation mode: activator (repressor)
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 9
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -133
Score: 6.7
Sequence: TTACCTGACTATTTTTGTCAGGTAT
Position: -106
Score: 6.9
Sequence: TTACTTGACTATTTTTGTCAGGTAT
Locus tag: Ping_1323
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Ping_1324
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: Ping_1325
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: Ping_1326
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: Ping_1327
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: Ping_1328
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: Ping_1329
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
Locus tag: Ping_1330
Name: yfhJ
Funciton: putative Fe-S cluster assembly protein
iscR
Iron-sulfur cluster regulator IscR
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
Chaperone protein HscB
hscA
Chaperone protein HscA
fdx
ferredoxin, 2Fe-2S type, ISC system
yfhJ
putative Fe-S cluster assembly protein

Position: -65
Score: 6.7
Sequence: ATACTTGAACTAATTAGTCAGGTAC
Locus tag: Ping_0867
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD