Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HutC in Verminephrobacter eiseniae EF01-2

Properties
Regulator type: Transcription factor
TF locus tag: Veis_3644
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Comamonadaceae
Statistics of regulated genes:
- Genes 10
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -100
Score: 5.4
Sequence: CAACCTGTATAGACAGGAAT
Locus tag: Veis_3641
Name: hisX
Funciton: Putative histidine ABC transporter, periplasmic substrate-binding protein
Locus tag: Veis_3642
Name: hisY
Funciton: Putative histidine ABC transporter, permease protein
Locus tag: Veis_3643
Name: hisZ
Funciton: Putative histidine ABC transporter, ATP-binding protein
Locus tag: Veis_3644
Name: hutC
Funciton: Histidine utilization repressor, GntR family
Locus tag: Veis_3645
Name: hutH
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Veis_3646
Name: hutU
Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Veis_3647
Name: hutD
Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Veis_3648
Name: hutI
Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Veis_3649
Name: hutF
Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Veis_3650
Name: hutG
Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
hisX
Putative histidine ABC transporter, periplasmic substrate-binding protein
hisY
Putative histidine ABC transporter, permease protein
hisZ
Putative histidine ABC transporter, ATP-binding protein
hutC
Histidine utilization repressor, GntR family
hutH
Histidine ammonia-lyase (EC 4.3.1.3)
hutU
Urocanate hydratase (EC 4.2.1.49)
hutD
Conserved hypothetical protein related to histidine degradation
hutI
Imidazolonepropionase (EC 3.5.2.7)
hutF
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutG
N-formylglutamate deformylase (EC 3.5.1.68)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD