Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HutC in Variovorax paradoxus S110

Properties
Regulator type: Transcription factor
TF locus tag: Vapar_0157
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Comamonadaceae
Statistics of regulated genes:
- Genes 13
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -176
Score: 5.1
Sequence: CTTCCTGTATAGACAGCAAT
Position: -110
Score: 5.7
Sequence: TATCCTGTATATACAAGTTG
Locus tag: Vapar_0154
Name: hisX
Funciton: Putative histidine ABC transporter, periplasmic substrate-binding protein
Locus tag: Vapar_0155
Name: hisY
Funciton: Putative histidine ABC transporter, permease protein
Locus tag: Vapar_0156
Name: hisZ
Funciton: Putative histidine ABC transporter, ATP-binding protein
Locus tag: Vapar_0157
Name: hutC
Funciton: Histidine utilization repressor, GntR family
hisX
Putative histidine ABC transporter, periplasmic substrate-binding protein
hisY
Putative histidine ABC transporter, permease protein
hisZ
Putative histidine ABC transporter, ATP-binding protein
hutC
Histidine utilization repressor, GntR family

Position: -22
Score: 5.6
Sequence: CTACTTGTATAGACAGGTTC
Locus tag: Vapar_0158
Name: hutH
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Vapar_0159
Name: hutU
Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Vapar_0160
Name: COG1414
Funciton: Transcriptional regulator, IclR family
Locus tag: Vapar_0161
Name: COG834 (HisJ)
Funciton: ABC amino acid transporter, periplasmic binding protein
Locus tag: Vapar_0162
Name: COG765 (HisM)
Funciton: ABC amino acid transporter, permease component
Locus tag: Vapar_0163
Name: hutD
Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Vapar_0164
Name: hutI
Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Vapar_0165
Name: hutF
Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Vapar_0166
Name: hutG
Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
hutH
Histidine ammonia-lyase (EC 4.3.1.3)
hutU
Urocanate hydratase (EC 4.2.1.49)
COG1414
Transcriptional regulator, IclR family
COG834 (HisJ)
ABC amino acid transporter, periplasmic binding protein
COG765 (HisM)
ABC amino acid transporter, permease component
hutD
Conserved hypothetical protein related to histidine degradation
hutI
Imidazolonepropionase (EC 3.5.2.7)
hutF
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutG
N-formylglutamate deformylase (EC 3.5.1.68)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD