Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HutC in Rhodoferax ferrireducens DSM 15236

Properties
Regulator type: Transcription factor
TF locus tag: Rfer_4157
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Comamonadaceae
Statistics of regulated genes:
- Genes 8
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -221
Score: 5.8
Sequence: AAAGTTGTCTATACAACTTA
Locus tag: Rfer_4161
Name: COG1414
Funciton: Transcriptional regulator, IclR family
Locus tag: Rfer_4160
Name: COG834 (HisJ)
Funciton: ABC amino acid transporter, periplasmic binding protein
Locus tag: Rfer_4159
Name: COG765 (HisM)
Funciton: ABC amino acid transporter, permease component
Locus tag: Rfer_4158
Name: COG1126 (GlnQ)
Funciton: ABC amino acid transporter, ATPase component
Locus tag: Rfer_4157
Name: hutC
Funciton: Histidine utilization repressor, GntR family
Locus tag: Rfer_4156
Name: hutD
Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Rfer_4155
Name: hutG
Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
Locus tag: Rfer_4154
Name: hutF
Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
COG1414
Transcriptional regulator, IclR family
COG834 (HisJ)
ABC amino acid transporter, periplasmic binding protein
COG765 (HisM)
ABC amino acid transporter, permease component
COG1126 (GlnQ)
ABC amino acid transporter, ATPase component
hutC
Histidine utilization repressor, GntR family
hutD
Conserved hypothetical protein related to histidine degradation
hutG
N-formylglutamate deformylase (EC 3.5.1.68)
hutF
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD