Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HutC in Polaromonas sp. JS666

Properties
Regulator type: Transcription factor
TF locus tag: Bpro_1044, Bpro_1165
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Comamonadaceae
Statistics of regulated genes:
- Genes 27
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -231
Score: 4.7
Sequence: ATACCTGTATAGACAGCGCA
Position: -109
Score: 5.4
Sequence: TTACCTGTATATACAGGTTG
Locus tag: Bpro_1047
Name: hisX
Funciton: Putative histidine ABC transporter, periplasmic substrate-binding protein
Locus tag: Bpro_1046
Name: hisY
Funciton: Putative histidine ABC transporter, permease protein
Locus tag: Bpro_1045
Name: hisZ
Funciton: Putative histidine ABC transporter, ATP-binding protein
Locus tag: Bpro_1044
Name: hutC
Funciton: Histidine utilization repressor, GntR family
hisX
Putative histidine ABC transporter, periplasmic substrate-binding protein
hisY
Putative histidine ABC transporter, permease protein
hisZ
Putative histidine ABC transporter, ATP-binding protein
hutC
Histidine utilization repressor, GntR family

Position: -25
Score: 5.6
Sequence: CAACTTGTATATACAGGACT
Locus tag: Bpro_1043
Name: hutH
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Bpro_1042
Name: hutU
Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Bpro_1041
Name: COG1414
Funciton: Transcriptional regulator, IclR family
Locus tag: Bpro_1040
Name: COG834 (HisJ)
Funciton: ABC amino acid transporter, periplasmic binding protein
Locus tag: Bpro_1039
Name: COG765 (HisM)
Funciton: ABC amino acid transporter, permease component
Locus tag: Bpro_1038
Name: COG1126 (GlnQ)
Funciton: ABC amino acid transporter, ATPase component
Locus tag: Bpro_1037
Name: COG5285
Funciton: Phytanoyl-CoA dioxygenase
Locus tag: Bpro_1036
Name: hutD
Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Bpro_1035
Name: hutI
Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Bpro_1034
Name: hutF
Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutH
Histidine ammonia-lyase (EC 4.3.1.3)
hutU
Urocanate hydratase (EC 4.2.1.49)
COG1414
Transcriptional regulator, IclR family
COG834 (HisJ)
ABC amino acid transporter, periplasmic binding protein
COG765 (HisM)
ABC amino acid transporter, permease component
COG1126 (GlnQ)
ABC amino acid transporter, ATPase component
COG5285
Phytanoyl-CoA dioxygenase
hutD
Conserved hypothetical protein related to histidine degradation
hutI
Imidazolonepropionase (EC 3.5.2.7)
hutF
Formiminoglutamic iminohydrolase (EC 3.5.3.13)

Position: -99
Score: 5.7
Sequence: CAAGTTGTATAGACAACTAC
Locus tag: Bpro_1164
Name: hutU
Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Bpro_1163
Name: COG2423
Funciton: Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)
Locus tag: Bpro_1162
Name: COG3221 (PhnD)
Funciton: ABC phosphate/phosphonate transporter, periplasmic binding component
Locus tag: Bpro_1161
Name: COG3181
Funciton: Uncharacterized conserved putative exported protein
Locus tag: Bpro_1160
Name: hutH
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
hutU
Urocanate hydratase (EC 4.2.1.49)
COG2423
Predicted ornithine cyclodeaminase, mu-crystallin homolog (EC 4.3.1.12)
COG3221 (PhnD)
ABC phosphate/phosphonate transporter, periplasmic binding component
COG3181
Uncharacterized conserved putative exported protein
hutH
Histidine ammonia-lyase (EC 4.3.1.3)

Position: -98
Score: 5.7
Sequence: GTAGTTGTCTATACAACTTG
Locus tag: Bpro_1165
Name: hutC
Funciton: Histidine utilization repressor, GntR family
Locus tag: Bpro_1166
Name: hutG
Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
hutC
Histidine utilization repressor, GntR family
hutG
N-formylglutamate deformylase (EC 3.5.1.68)

Position: -120
Score: 5.3
Sequence: CAACTTGTATATACAAGCGA
Locus tag: Bpro_1159
Name: COG2855
Funciton: Predicted membrane protein
COG2855
Predicted membrane protein

Position: -158
Score: 5.3
Sequence: TCGCTTGTATATACAAGTTG
Locus tag: Bpro_1158
Name: COG1732 (OpuBC)
Funciton: ABC proline/glycine/betaine transporter, periplasmic binding domain
Locus tag: Bpro_1157
Name: hutH2
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Bpro_1156
Name: COG1174 (OpuBB)
Funciton: ABC proline/glycine/betaine transporter, permease component
Locus tag: Bpro_1155
Name: COG1174 (OpuBB)
Funciton: ABC proline/glycine/betaine transporter, permease component
Locus tag: Bpro_1154
Name: COG1125 (OpuBA)
Funciton: ABC proline/glycine/betaine transporter, ATPase component
COG1732 (OpuBC)
ABC proline/glycine/betaine transporter, periplasmic binding domain
hutH2
Histidine ammonia-lyase (EC 4.3.1.3)
COG1174 (OpuBB)
ABC proline/glycine/betaine transporter, permease component
COG1174 (OpuBB)
ABC proline/glycine/betaine transporter, permease component
COG1125 (OpuBA)
ABC proline/glycine/betaine transporter, ATPase component
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD