Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HutC in Comamonas testosteroni KF-1

Properties
Regulator type: Transcription factor
TF locus tag: CtesDRAFT_4038, CtesDRAFT_4040
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Comamonadaceae
Statistics of regulated genes:
- Genes 8
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -24
Score: 4.6
Sequence: TTGACTGTATAGACAGGTAT
Locus tag: CtesDRAFT_4039
Name: hutH
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
hutH
Histidine ammonia-lyase (EC 4.3.1.3)

Position: -164
Score: 4.5
Sequence: ATGCATGTCTATACAGCTGT
Position: -117
Score: 5.1
Sequence: AAGCCTGTATATACATGTTC
Locus tag: CtesDRAFT_4035
Name: hisX
Funciton: Putative histidine ABC transporter, periplasmic substrate-binding protein
Locus tag: CtesDRAFT_4036
Name: hisY
Funciton: Putative histidine ABC transporter, permease protein
Locus tag: CtesDRAFT_4037
Name: hisZ
Funciton: Putative histidine ABC transporter, ATP-binding protein
Locus tag: CtesDRAFT_4038
Name: hutC
Funciton: Histidine utilization repressor, GntR family
hisX
Putative histidine ABC transporter, periplasmic substrate-binding protein
hisY
Putative histidine ABC transporter, permease protein
hisZ
Putative histidine ABC transporter, ATP-binding protein
hutC
Histidine utilization repressor, GntR family

Position: -85
Score: 4.9
Sequence: AAATTCGTATAGACAACTTT
Locus tag: CtesDRAFT_4041
Name: COG1457 (CodB)
Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
Locus tag: CtesDRAFT_4042
Name: hutU
Funciton: Urocanate hydratase (EC 4.2.1.49)
COG1457 (CodB)
Permease, cytosine/purines, uracil, thiamine, allantoin family protein
hutU
Urocanate hydratase (EC 4.2.1.49)

Position: -80
Score: 4.9
Sequence: AAAGTTGTCTATACGAATTT
Locus tag: CtesDRAFT_4040
Name: hutC
Funciton: Histidine utilization repressor, GntR family
hutC
Histidine utilization repressor, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD