Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HutC in Acidovorax avenae subsp. citrulli AAC00-1

Properties
Regulator type: Transcription factor
TF locus tag: Aave_2966
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Comamonadaceae
Statistics of regulated genes:
- Genes 11
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -85
Score: 5.1
Sequence: AACCCTGTATAGACAGCATG
Locus tag: Aave_2969
Name: hisX
Funciton: Putative histidine ABC transporter, periplasmic substrate-binding protein
Locus tag: Aave_2968
Name: hisY
Funciton: Putative histidine ABC transporter, permease protein
Locus tag: Aave_2967
Name: hisZ
Funciton: Putative histidine ABC transporter, ATP-binding protein
Locus tag: Aave_2966
Name: hutC
Funciton: Histidine utilization repressor, GntR family
hisX
Putative histidine ABC transporter, periplasmic substrate-binding protein
hisY
Putative histidine ABC transporter, permease protein
hisZ
Putative histidine ABC transporter, ATP-binding protein
hutC
Histidine utilization repressor, GntR family

Position: -102
Score: 5.6
Sequence: CAGCCTGTATATACAAGTTG
Position: -24
Score: 5.2
Sequence: TGACTTGTATATACAGGAAA
Locus tag: Aave_2965
Name: hutH
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Aave_2964
Name: hutU
Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: Aave_2963
Name: COG5285
Funciton: Phytanoyl-CoA dioxygenase
Locus tag: Aave_2962
Name: hutD
Funciton: Conserved hypothetical protein related to histidine degradation
Locus tag: Aave_2961
Name: hutI
Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Aave_2960
Name: hutF
Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Aave_2959
Name: hutG
Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
hutH
Histidine ammonia-lyase (EC 4.3.1.3)
hutU
Urocanate hydratase (EC 4.2.1.49)
COG5285
Phytanoyl-CoA dioxygenase
hutD
Conserved hypothetical protein related to histidine degradation
hutI
Imidazolonepropionase (EC 3.5.2.7)
hutF
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutG
N-formylglutamate deformylase (EC 3.5.1.68)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD