Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HutC in Stenotrophomonas maltophilia K279a

Properties
Regulator type: Transcription factor
TF locus tag: Smlt3105
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Xanthomonadales
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 6 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -33
Score: 5
Sequence: TATATTGTATAGACATATAA
Locus tag: Smlt3107
Name: hutI
Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: Smlt3108
Name: hutH
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: Smlt3109
Name: hutG
Funciton: N-formylglutamate deformylase (EC 3.5.1.68)
Locus tag: Smlt3110
Name: hutU
Funciton: Urocanate hydratase (EC 4.2.1.49)
hutI
Imidazolonepropionase (EC 3.5.2.7)
hutH
Histidine ammonia-lyase (EC 4.3.1.3)
hutG
N-formylglutamate deformylase (EC 3.5.1.68)
hutU
Urocanate hydratase (EC 4.2.1.49)

Position: -45
Score: 4.3
Sequence: TTATATGTCTATACAATATA
Locus tag: Smlt3106
Name: hutF
Funciton: Formiminoglutamic iminohydrolase (EC 3.5.3.13)
Locus tag: Smlt3105
Name: hutC
Funciton: Histidine utilization repressor
hutF
Formiminoglutamic iminohydrolase (EC 3.5.3.13)
hutC
Histidine utilization repressor
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD