Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HutC in Psychrobacter sp. PRwf-1

Properties
Regulator type: Transcription factor
TF locus tag: PsycPRwf_0853
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Moraxellaceae
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -54
Score: 5
Sequence: TAATTTGTATATACAAAATC
Locus tag: PsycPRwf_0852
Name: hutU
Funciton: Urocanate hydratase (EC 4.2.1.49)
hutU
Urocanate hydratase (EC 4.2.1.49)

Position: -207
Score: 4
Sequence: TAATTTGTCTATAGACATAG
Position: -28
Score: 4
Sequence: TTATTGCTACAGACAAGGAT
Locus tag: PsycPRwf_0851
Name: COG3314
Funciton: Predicted histidine uptake transporter
Locus tag: PsycPRwf_0850
Name: hutH
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: PsycPRwf_0849
Name: hutG2
Funciton: Formiminoglutamase (EC 3.5.3.8)
Locus tag: PsycPRwf_0848
Name: hutI
Funciton: Imidazolonepropionase (EC 3.5.2.7)
COG3314
Predicted histidine uptake transporter
hutH
Histidine ammonia-lyase (EC 4.3.1.3)
hutG2
Formiminoglutamase (EC 3.5.3.8)
hutI
Imidazolonepropionase (EC 3.5.2.7)

Position: -156
Score: 5
Sequence: GATTTTGTATATACAAATTA
Locus tag: PsycPRwf_0853
Name: hutC
Funciton: Histidine utilization repressor, GntR family
hutC
Histidine utilization repressor, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD