Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HutC in Acinetobacter baumannii AB0057

Properties
Regulator type: Transcription factor
TF locus tag: AB57_3862
Regulator family: GntR/Others
Regulation mode: repressor
Biological process: Histidine utilization
Effector: cis-Urocanic acid
Regulog: HutC - Moraxellaceae
Statistics of regulated genes:
- Genes 8
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -83
Score: 6
Sequence: TAACTTGTATATACATGTTT
Locus tag: AB57_1739
Name: COG1457 (CodB)
Funciton: Permease, cytosine/purines, uracil, thiamine, allantoin family protein
COG1457 (CodB)
Permease, cytosine/purines, uracil, thiamine, allantoin family protein

Position: -90
Score: 5.6
Sequence: ATGGATGTATATACAAGTTA
Locus tag: AB57_3860
Name: hutU
Funciton: Urocanate hydratase (EC 4.2.1.49)
Locus tag: AB57_3859
Name: hutH
Funciton: Histidine ammonia-lyase (EC 4.3.1.3)
Locus tag: AB57_3858
Name: hisT
Funciton: Histidine transport protein (permease)
Locus tag: AB57_3857
Name: hutI
Funciton: Imidazolonepropionase (EC 3.5.2.7)
Locus tag: AB57_3856
Name: hutG2
Funciton: Formiminoglutamase (EC 3.5.3.8)
hutU
Urocanate hydratase (EC 4.2.1.49)
hutH
Histidine ammonia-lyase (EC 4.3.1.3)
hisT
Histidine transport protein (permease)
hutI
Imidazolonepropionase (EC 3.5.2.7)
hutG2
Formiminoglutamase (EC 3.5.3.8)

Position: -67
Score: 4.5
Sequence: GTGGTTGTATATACATAGCA
Locus tag: AB57_3862
Name: hutC
Funciton: Histidine utilization repressor, GntR family
Locus tag: AB57_3861
Name: hutD
Funciton: Conserved hypothetical protein related to histidine degradation
hutC
Histidine utilization repressor, GntR family
hutD
Conserved hypothetical protein related to histidine degradation
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD