Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Granulibacter bethesdensis CGDNIH1

Properties
Regulator type: Transcription factor
TF locus tag: GbCGDNIH1_1212
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhodospirillales
Statistics of regulated genes:
- Genes 6
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -172
Score: 5.9
Sequence: TATATGTTATAACATAACACAAT
Locus tag: GbCGDNIH1_1210
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: GbCGDNIH1_1209
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: GbCGDNIH1_1208
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -63
Score: 6.1
Sequence: TGTTTGTTATGTTATAACATAAC
Locus tag: GbCGDNIH1_0784
Name: PF08856
Funciton: Hypothetical protein
PF08856
Hypothetical protein

Position: -28
Score: 6.1
Sequence: AACATGTCATGTTATAACATAAC
Locus tag: GbCGDNIH1_1357
Name: omr
Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
omr
Predicted zinc-regulated TonB-dependent outer membrane transporter

Position: -57
Score: 6.4
Sequence: TAAACGTTATGTTATAACATAAC
Locus tag: GbCGDNIH1_1545
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciC
Putative zinc chaperone, COG0523 family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD