Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Acetobacter pasteurianus IFO 3283-01

Properties
Regulator type: Transcription factor
TF locus tag: APA01_22640
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhodospirillales
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 5.8
Sequence: AAAATGTAATAGTATTACATTGC
Locus tag: APA01_22630
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: APA01_22620
Name: znuC2
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: APA01_22610
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuA2
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC2
Zinc ABC transporter, ATP-binding protein ZnuC
znuB2
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -66
Score: 5.9
Sequence: GTAATGTTATAGTGTTACATAAT
Locus tag: APA01_04190
Name: omr
Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
omr
Predicted zinc-regulated TonB-dependent outer membrane transporter

Position: -105
Score: 5.7
Sequence: GCAATGTAATACTATTACATTTT
Locus tag: APA01_22640
Name: zur
Funciton: Zinc uptake regulation protein Zur
zur
Zinc uptake regulation protein Zur
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD