Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Azospirillum sp. B510

Properties
Regulator type: Transcription factor
TF locus tag: AZL_019410
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhodospirillales
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -54
Score: 6
Sequence: TGTACGTTATGATATAACATTAC
Locus tag: AZL_004800
Name: PF08856
Funciton: Hypothetical protein
Locus tag: AZL_004790
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: AZL_004780
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: AZL_004770
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
PF08856
Hypothetical protein
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -129
Score: 5.3
Sequence: GTCACGTTATAACGTAACATGTC
Locus tag: AZL_d00760
Name: znuC3
Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: AZL_d00750
Name: znuB3
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC3
ABC-type Mn/Zn transport systems, ATPase component
znuB3
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -94
Score: 5.9
Sequence: GACATGTTACGTTATAACGTGAC
Locus tag: AZL_d00770
Name: znuA3
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA3
Zinc ABC transporter, periplasmic-binding protein ZnuA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD