Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Magnetospirillum magneticum AMB-1

Properties
Regulator type: Transcription factor
TF locus tag: amb2309
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhodospirillales
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 27 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -36
Score: 6.4
Sequence: GGAATGTTATAATATAACAAATC
Locus tag: amb2309
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: amb2310
Name: znuC3
Funciton: ABC-type Mn/Zn transport systems, ATPase component
Locus tag: amb2311
Name: znuB3
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein Zur
znuC3
ABC-type Mn/Zn transport systems, ATPase component
znuB3
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -53
Score: 6.4
Sequence: GATTTGTTATATTATAACATTCC
Locus tag: amb2308
Name: znuA3
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA3
Zinc ABC transporter, periplasmic-binding protein ZnuA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD