Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Hyphomonas neptunium ATCC 15444

Properties
Regulator type: Transcription factor
TF locus tag: HNE_0655
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhodobacterales
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 36 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -44
Score: 5.4
Sequence: GTAATGCAATATTATTACATTAC
Locus tag: HNE_1973
Name: omr
Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
omr
Predicted zinc-regulated TonB-dependent outer membrane transporter
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD