Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Roseovarius sp. 217

Properties
Regulator type: Transcription factor
TF locus tag: ROS217_23042
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhodobacterales
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 36 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -32
Score: 5.3
Sequence: TGAATGTTATGATATCACATATG
Locus tag: ROS217_23037
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -98
Score: 5.5
Sequence: CATATGTGATATCATAACATTCA
Locus tag: ROS217_23042
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: ROS217_23047
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: ROS217_23052
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein Zur
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD