Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Bradyrhizobium japonicum USDA 110

Properties
Regulator type: Transcription factor
TF locus tag: blr0934
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhizobiales
Statistics of regulated genes:
- Genes 7
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 42 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -3
Score: 5.3
Sequence: GCGATGTTACATTATAACATCGC
Locus tag: bll2461
Name: PF11162
Funciton: Conserved hypothetical protein
Locus tag: bll2460
Name: omr
Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
PF11162
Conserved hypothetical protein
omr
Predicted zinc-regulated TonB-dependent outer membrane transporter

Position: -259
Score: 5.9
Sequence: GTAATGTTATAATATAACGTCCA
Locus tag: bll7771
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: bll7770
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: bll7769
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: bll7768
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: bll7767
Name: PF00400
Funciton: Conserved hypothetical protein
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
yciC
Putative zinc chaperone, COG0523 family
PF00400
Conserved hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD