Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Rhodopseudomonas palustris CGA009

Properties
Regulator type: Transcription factor
TF locus tag: RPA0517
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhizobiales
Statistics of regulated genes:
- Genes 8
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 42 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -65
Score: 5.8
Sequence: TTTATGTAATGTTATAACGTTTC
Locus tag: RPA1462
Name: yciC2
Funciton: Putative Putative zinc chaperone, COG0523 family
yciC2
Putative Putative zinc chaperone, COG0523 family

Position: -44
Score: 5.2
Sequence: GCAATGTTACTTTATAACATCGG
Locus tag: RPA4384
Name: PF11162
Funciton: Conserved hypothetical protein
Locus tag: RPA4385
Name: omr
Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
PF11162
Conserved hypothetical protein
omr
Predicted zinc-regulated TonB-dependent outer membrane transporter

Position: -248
Score: 5.1
Sequence: ATAATGTTATAATGTAACAGGTT
Locus tag: RPA0858
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: RPA0859
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: RPA0860
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: RPA0861
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: RPA0862
Name: PF00400
Funciton: Conserved hypothetical protein
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
yciC
Putative zinc chaperone, COG0523 family
PF00400
Conserved hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD