Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Brucella melitensis 16M

Properties
Regulator type: Transcription factor
TF locus tag: BMEII0175
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhizobiales
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 42 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -106
Score: 5.3
Sequence: CAGACGTTATAGCATAACGTAAT
Locus tag: BMEII0178
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: BMEII0179
Name: yciC2
Funciton: Putative Putative zinc chaperone, COG0523 family
znuA2
Zinc ABC transporter, periplasmic-binding protein ZnuA
yciC2
Putative Putative zinc chaperone, COG0523 family

Position: -183
Score: 5.4
Sequence: GATATGTTATTTTATTACGCAAA
Locus tag: BMEII0177
Name: znuC2
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: BMEII0176
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: BMEII0175
Name: zur
Funciton: Zinc uptake regulation protein Zur
znuC2
Zinc ABC transporter, ATP-binding protein ZnuC
znuB2
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein Zur
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD