Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Mesorhizobium sp. BNC1

Properties
Regulator type: Transcription factor
TF locus tag: Meso_4003
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhizobiales
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 42 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -105
Score: 5.6
Sequence: CAAGTGTAATGTCATAACGTTTA
Locus tag: Meso_4006
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA2
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -77
Score: 5.5
Sequence: TAAACGTTATGACATTACACTTG
Locus tag: Meso_4005
Name: znuC2
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Meso_4004
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Meso_4003
Name: zur
Funciton: Zinc uptake regulation protein Zur
znuC2
Zinc ABC transporter, ATP-binding protein ZnuC
znuB2
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein Zur
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD