Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type: Transcription factor
TF locus tag: RL3175
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Rhizobiales
Statistics of regulated genes:
- Genes 10
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 42 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -124
Score: 5.3
Sequence: GCGATGTGATCTTATAACATTAT
Locus tag: RL4148
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
Locus tag: RL4149
Name: PF00400
Funciton: Conserved hypothetical protein
yciC
Putative zinc chaperone, COG0523 family
PF00400
Conserved hypothetical protein

Position: -158
Score: 5.4
Sequence: TAACCGTAATGTTATTACATTGT
Locus tag: RL1047
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: RL1048
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: RL1049
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -89
Score: 5.7
Sequence: TTGATGTAATAACATAACAATTG
Locus tag: RL3178
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA2
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -44
Score: 6.2
Sequence: CAAATGTAATGATATAACATAAA
Locus tag: RL3179
Name: yciC2
Funciton: Putative Putative zinc chaperone, COG0523 family
yciC2
Putative Putative zinc chaperone, COG0523 family

Position: -81
Score: 5.8
Sequence: CAATTGTTATGTTATTACATCAA
Locus tag: RL3177
Name: znuC2
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: RL3176
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: RL3175
Name: zur
Funciton: Zinc uptake regulation protein Zur
znuC2
Zinc ABC transporter, ATP-binding protein ZnuC
znuB2
Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein Zur
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD