Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Polaromonas naphthalenivorans CJ2

Properties
Regulator type: Transcription factor
TF locus tag: Pnap_1145
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Comamonadaceae
Statistics of regulated genes:
- Genes 8
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -77
Score: 6.5
Sequence: ATAATGCAACCTGATTGCGATAG
Position: -45
Score: 6.6
Sequence: GTAACGCAACTGAATTGCATTAA
Locus tag: Pnap_1145
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Pnap_1146
Name: COG2884
Funciton: ABC transporter-related protein
Locus tag: Pnap_1147
Name: COG4591
Funciton: Predicted ABC transport system, permease protein
Locus tag: Pnap_1148
Name: Aave_2810
Funciton: Conserved hypothetical protein
Locus tag: Pnap_1149
Name: PF11736
Funciton: Lipoprotein, putative
zur
Zinc uptake regulation protein Zur
COG2884
ABC transporter-related protein
COG4591
Predicted ABC transport system, permease protein
Aave_2810
Conserved hypothetical protein
PF11736
Lipoprotein, putative

Position: -251
Score: 6.5
Sequence: TTAATGCAATTCAGTTGCGTTAC
Position: -219
Score: 6.1
Sequence: CTATCGCAATCAGGTTGCATTAT
Locus tag: Pnap_1144
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Pnap_1143
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: Pnap_1142
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD