Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Delftia acidovorans SPH-1

Properties
Regulator type: Transcription factor
TF locus tag: Daci_3951
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Comamonadaceae
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -72
Score: 6.9
Sequence: ATAATGCAACCCGGTTGCGATAA
Locus tag: Daci_3951
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Daci_3950
Name: Aave_2810
Funciton: Conserved hypothetical protein
Locus tag: Daci_3949
Name: COG4531
Funciton: Predicted zinc-binding periplasmic protein
Locus tag: Daci_3948
Name: omr
Funciton: Predicted zinc-regulated TonB-dependent outer membrane transporter
zur
Zinc uptake regulation protein Zur
Aave_2810
Conserved hypothetical protein
COG4531
Predicted zinc-binding periplasmic protein
omr
Predicted zinc-regulated TonB-dependent outer membrane transporter
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD