Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Burkholderia vietnamiensis G4

Properties
Regulator type: Transcription factor
TF locus tag: Bcep1808_2713
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Burkholderia
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -53
Score: 6.3
Sequence: GGCGAGATACGTTATATCATCGC
Locus tag: Bcep1808_2713
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Bcep1808_2714
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Bcep1808_2715
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Bcep1808_2716
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein Zur
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -179
Score: 4.9
Sequence: GAAATGATATAACGTATCATCTT
Position: -74
Score: 5.1
Sequence: ACGATGCAACAATATATCGTTTC
Locus tag: Bcep1808_4992
Name: omr
Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
omr
Predicted zinc-related TonB-dependent outer membrane transporter
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD