Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Burkholderia sp. 383

Properties
Regulator type: Transcription factor
TF locus tag: Bcep18194_A5930
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Burkholderia
Statistics of regulated genes:
- Genes 14
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -53
Score: 6.1
Sequence: ACGGCGATACGTTATATCATCGC
Locus tag: Bcep18194_A5930
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: Bcep18194_A5931
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: Bcep18194_A5932
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Bcep18194_A5933
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein Zur
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -8
Score: 6.1
Sequence: GAAATGATATGTTATATCGTTGC
Locus tag: Bcep18194_B0316
Name: yciC
Funciton: Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
Locus tag: Bcep18194_B0317
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
Locus tag: Bcep18194_B0318
Name: queD2
Funciton: 6-pyruvoyl-tetrahydropterin synthase-like
Locus tag: Bcep18194_B0319
Name: can2
Funciton: Carbonic anhydrase
Locus tag: Bcep18194_B0320
Name: pyrC2
Funciton: Dihydroorotase (EC 3.5.2.3)
yciC
Putative metal chaperone, involved in Zn homeostasis, GTPase of COG0523 family
folE2
GTP cyclohydrolase I (EC 3.5.4.16) type 2
queD2
6-pyruvoyl-tetrahydropterin synthase-like
can2
Carbonic anhydrase
pyrC2
Dihydroorotase (EC 3.5.2.3)

Position: -209
Score: 5.3
Sequence: GAATTGATATTTTGTATCATCTG
Locus tag: Bcep18194_A4489
Name: omr1
Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: Bcep18194_A4490
Name: fecE
Funciton: Iron-siderophore ABC transport system, ATP-binding protein
Locus tag: Bcep18194_A4491
Name: fecC
Funciton: Iron-siderophore ABC transport system, substrate-binding protein
Locus tag: Bcep18194_A4492
Name: fecD
Funciton: Iron-siderophore ABC transport system, permease protein
omr1
Predicted zinc-related TonB-dependent outer membrane transporter
fecE
Iron-siderophore ABC transport system, ATP-binding protein
fecC
Iron-siderophore ABC transport system, substrate-binding protein
fecD
Iron-siderophore ABC transport system, permease protein

Position: -182
Score: 5.7
Sequence: GAAATGATATAACATATCATTTC
Locus tag: Bcep18194_B1524
Name: omr
Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
omr
Predicted zinc-related TonB-dependent outer membrane transporter
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD