Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Burkholderia pseudomallei K96243

Properties
Regulator type: Transcription factor
TF locus tag: BPSL0825
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Burkholderia
Statistics of regulated genes:
- Genes 9
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 22 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -51
Score: 6
Sequence: GCGCGGATACGTTATATCATCAC
Locus tag: BPSL0825
Name: zur
Funciton: Zinc uptake regulation protein Zur
Locus tag: BPSL0824
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: BPSL0823
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: BPSL0822
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein Zur
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -303
Score: 5.8
Sequence: CGGATGATATGTTATATCATCGT
Locus tag: BPSL2724
Name: omr1
Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
Locus tag: BPSL2723
Name: fecE
Funciton: Iron-siderophore ABC transport system, ATP-binding protein
Locus tag: BPSL2722
Name: fecC
Funciton: Iron-siderophore ABC transport system, substrate-binding protein
Locus tag: BPSL2721
Name: fecD
Funciton: Iron-siderophore ABC transport system, permease protein
omr1
Predicted zinc-related TonB-dependent outer membrane transporter
fecE
Iron-siderophore ABC transport system, ATP-binding protein
fecC
Iron-siderophore ABC transport system, substrate-binding protein
fecD
Iron-siderophore ABC transport system, permease protein

Position: -199
Score: 4.8
Sequence: GAAATGATATAACATATCGATAC
Position: -87
Score: 6.1
Sequence: ATATTGATACGTTATATCGTTTC
Locus tag: BPSS1850
Name: omr
Funciton: Predicted zinc-related TonB-dependent outer membrane transporter
omr
Predicted zinc-related TonB-dependent outer membrane transporter
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD