Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type: Transcription factor
TF locus tag: XCC2685
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Xanthomonadales
Statistics of regulated genes:
- Genes 5
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -41
Score: 5.6
Sequence: GAGTTGTTATACAGTAACATTTC
Locus tag: XCC0257
Name: yciC
Funciton: Putative zinc chaperone, COG0523 family
yciC
Putative zinc chaperone, COG0523 family

Position: -56
Score: 4.7
Sequence: ATTACGTTATAATATATCGATAC
Locus tag: XCC2046
Name: omr2
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
omr2
predicted zinc-related TonB-dependent outer membrane transporter

Position: -138
Score: 5.4
Sequence: GACGTGGAATAATATAACATCTT
Locus tag: XCC2658
Name: omr1
Funciton: predicted zinc-related TonB-dependent outer membrane transporter
omr1
predicted zinc-related TonB-dependent outer membrane transporter

Position: -152
Score: 5.5
Sequence: CTAGTGTTACTTTATAACACTTG
Locus tag: XCC1763
Name: amiC
Funciton: N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
Locus tag: XCC1764
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
amiC
N-acetylmuramoyl-L-alanine amidase (EC 3.5.1.28)
folE2
GTP cyclohydrolase I (EC 3.5.4.16) type 2
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD