Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Psychrobacter sp. PRwf-1

Properties
Regulator type: Transcription factor
TF locus tag: PsycPRwf_0184
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Moraxellaceae
Statistics of regulated genes:
- Genes 9
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -142
Score: 6.1
Sequence: TATTAGTTATAGTATAACATATC
Locus tag: PsycPRwf_0185
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -92
Score: 6.8
Sequence: GTTATGTTATACTATAACATAAC
Locus tag: PsycPRwf_2339
Name: omr1
Funciton: Zinc-regulated outer membrane receptor
omr1
Zinc-regulated outer membrane receptor

Position: -86
Score: 6.8
Sequence: GTTATGTTATAGTATAACATAAC
Locus tag: PsycPRwf_2340
Name: omr1
Funciton: Zinc-regulated outer membrane receptor
omr1
Zinc-regulated outer membrane receptor

Position: -408
Score: 5.8
Sequence: GATATGTTATACTATAACTAATA
Locus tag: PsycPRwf_0184
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: PsycPRwf_0183
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: PsycPRwf_0182
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein ZUR
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -100
Score: 6.4
Sequence: TTATTGTTATAATATAACATACT
Locus tag: PsycPRwf_1910
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA2
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -97
Score: 5
Sequence: AAAACGTTATGTTATACTATAAC
Locus tag: PsycPRwf_2339
Name: omr2
Funciton: Zinc-regulated outer membrane receptor
omr2
Zinc-regulated outer membrane receptor

Position: -121
Score: 6.6
Sequence: TTAATGTTATGTTATAACATAAT
Locus tag: PsycPRwf_1926
Name: PsycPRwf_1926
Funciton: LSU ribosomal protein L36p
PsycPRwf_1926
LSU ribosomal protein L36p
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD