Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Psychrobacter arcticum 273-4

Properties
Regulator type: Transcription factor
TF locus tag: Psyc_2033
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Moraxellaceae
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -165
Score: 5.7
Sequence: AAATTGATATATTATAAAATAAT
Locus tag: Psyc_1790
Name: Psyc_1790
Funciton: Zn-dependent hydrolases, including glyoxylases
Psyc_1790
Zn-dependent hydrolases, including glyoxylases

Position: -187
Score: 6.8
Sequence: ATTATGTTATACTATAACATAAT
Locus tag: Psyc_2033
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: Psyc_2034
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Psyc_2035
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein ZUR
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -83
Score: 6.8
Sequence: ATTATGTTATAGTATAACATAAT
Locus tag: Psyc_2032
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD