Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Acinetobacter baumannii AB0057

Properties
Regulator type: Transcription factor
TF locus tag: AB57_0184
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Moraxellaceae
Statistics of regulated genes:
- Genes 9
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -77
Score: 6.4
Sequence: GTTATGTTATAACATAACATTAT
Locus tag: AB57_3864
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
yciC
Putative metal chaperone, GTPase of COG0523 family

Position: -51
Score: 5.8
Sequence: ACTTTGTTATATTATAACATGCT
Locus tag: AB57_0185
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -51
Score: 6.7
Sequence: GAAATGTTATAATATAACAAAAC
Locus tag: AB57_3396
Name: omr1
Funciton: Zinc-regulated outer membrane receptor
omr1
Zinc-regulated outer membrane receptor

Position: -111
Score: 5.9
Sequence: AGCATGTTATAATATAACAAAGT
Locus tag: AB57_0184
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: AB57_0183
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: AB57_0182
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein ZUR
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -41
Score: 6
Sequence: TAAGTGTTATATTATAATATAAC
Locus tag: AB57_3926
Name: omr1
Funciton: Zinc-regulated outer membrane receptor
omr1
Zinc-regulated outer membrane receptor

Position: -54
Score: 5.9
Sequence: GTAACGTTATACTATTACATTTA
Locus tag: AB57_0135
Name: omr3
Funciton: Ferrichrome-iron receptor
omr3
Ferrichrome-iron receptor

Position: -54
Score: 6
Sequence: TGAGTGTTATGTTATAACATTTC
Locus tag: AB57_0468
Name: rpmE2
Funciton: LSU ribosomal protein L31p
rpmE2
LSU ribosomal protein L31p
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD