Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Acinetobacter sp. ADP1

Properties
Regulator type: Transcription factor
TF locus tag: ACIAD0176
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Moraxellaceae
Statistics of regulated genes:
- Genes 17
- Operons 11
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 28 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -128
Score: 6.4
Sequence: TATATGTTACATTATAACATAAC
Locus tag: ACIAD1741
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: ACIAD1740
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
yciC
Putative metal chaperone, GTPase of COG0523 family
folE2
GTP cyclohydrolase I (EC 3.5.4.16) type 2

Position: -36
Score: 5.7
Sequence: AATTTGTTATAATATAACACAAG
Locus tag: ACIAD0177
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -54
Score: 6.2
Sequence: GTAATGTTATAGTATTACAATTA
Locus tag: ACIAD1003
Name: omr3
Funciton: Ferrichrome-iron receptor
omr3
Ferrichrome-iron receptor

Position: -97
Score: 6.1
Sequence: CTTGTGTTATATTATAACAAATT
Locus tag: ACIAD0176
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: ACIAD0175
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: ACIAD0174
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein ZUR
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -25
Score: 5.5
Sequence: AAATAGATATATTATAACGTAAC
Locus tag: ACIAD0612
Name: omr1
Funciton: Zinc-regulated outer membrane receptor
omr1
Zinc-regulated outer membrane receptor

Position: -64
Score: 6.2
Sequence: GCAATGTTATAATATTACAAAAA
Locus tag: ACIAD0611
Name: omr1
Funciton: Zinc-regulated outer membrane receptor
omr1
Zinc-regulated outer membrane receptor

Position: -44
Score: 5.1
Sequence: CCAATGTTATAATGTAACAGTTA
Locus tag: ACIAD1742
Name: null
Funciton: hypothetical protein; putative signal peptide
hypothetical protein; putative signal peptide

Position: -101
Score: 6.3
Sequence: TATTTGTTATGTTATAACATAAC
Locus tag: ACIAD1420
Name: can
Funciton: Carbonic anhydrase, gamma class (EC 4.2.1.1)
Locus tag: ACIAD1419
Name: ACIAD1419
Funciton: Dihydroorotase (EC 3.5.2.3)
can
Carbonic anhydrase, gamma class (EC 4.2.1.1)
ACIAD1419
Dihydroorotase (EC 3.5.2.3)

Position: -253
Score: 5.7
Sequence: AAAGTATTATGTTATAACATAAT
Locus tag: ACIAD0507
Name: tonB
Funciton: Ferric siderophore transport system, periplasmic binding protein TonB
Locus tag: ACIAD0508
Name: exbB
Funciton: MotA/TolQ/ExbB proton channel family protein
Locus tag: ACIAD0509
Name: exbD
Funciton: Biopolymer transport protein ExbD/TolR
tonB
Ferric siderophore transport system, periplasmic binding protein TonB
exbB
MotA/TolQ/ExbB proton channel family protein
exbD
Biopolymer transport protein ExbD/TolR

Position: -54
Score: 6.2
Sequence: AAAATGAAATAATATAACATTAC
Locus tag: ACIAD0425
Name: rpmE2
Funciton: LSU ribosomal protein L31p
rpmE2
LSU ribosomal protein L31p

Position: -43
Score: 5
Sequence: GGAATGTTATAGTATTTGAAATT
Locus tag: ACIAD1328
Name: ACIAD1328
Funciton: Zinc metalloprotease (EC 3.4.24.-)
ACIAD1328
Zinc metalloprotease (EC 3.4.24.-)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD