Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Alcanivorax borkumensis SK2

Properties
Regulator type: Transcription factor
TF locus tag: ABO_1677
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 12
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -56
Score: 5.7
Sequence: TTCATGTTATGTTATAACATTGC
Position: -51
Score: 4.9
Sequence: GTTATGTTATAACATTGCATCAA
Locus tag: ABO_1681
Name: null
Funciton: hypothetical protein
Locus tag: ABO_1682
Name: can
Funciton: Carbonic anhydrase (EC 4.2.1.1)
Locus tag: ABO_1683
Name: pyrC2
Funciton: Dihydroorotase (EC 3.5.2.3)
hypothetical protein
can
Carbonic anhydrase (EC 4.2.1.1)
pyrC2
Dihydroorotase (EC 3.5.2.3)

Position: -34
Score: 5.7
Sequence: GCAATGTTATAACATAACATGAA
Locus tag: ABO_1680
Name: dksA2
Funciton: C4-type zinc finger protein, DksA/TraR family
Locus tag: ABO_1679
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: ABO_1678
Name: PF08856
Funciton: hypothetical protein
Locus tag: ABO_1677
Name: zur2
Funciton: Zinc uptake regulation protein ZUR
Locus tag: ABO_1676
Name: null
Funciton: hypothetical protein
Locus tag: ABO_1675
Name: zbp
Funciton: Predicted zinc-binding protein
Locus tag: ABO_1674
Name: null
Funciton: Methionine ABC transporter ATP-binding protein
Locus tag: ABO_1673
Name: null
Funciton: ABC-type antimicrobial peptide transport system, permease component
Locus tag: ABO_1672
Name: null
Funciton: lipoprotein, putative
dksA2
C4-type zinc finger protein, DksA/TraR family
yciC
Putative metal chaperone, GTPase of COG0523 family
PF08856
hypothetical protein
zur2
Zinc uptake regulation protein ZUR
hypothetical protein
zbp
Predicted zinc-binding protein
Methionine ABC transporter ATP-binding protein
ABC-type antimicrobial peptide transport system, permease component
lipoprotein, putative
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD