Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Reinekea sp. MED297

Properties
Regulator type: Transcription factor
TF locus tag: MED297_11305, MED297_00400
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 7
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -61
Score: 5.6
Sequence: GTTATGATACATCATATCATTTA
Locus tag: MED297_11280
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -77
Score: 5.9
Sequence: TTAATGATATATCATATCATTTA
Locus tag: MED297_00400
Name: zur2
Funciton: Zinc uptake regulation protein paralog
zur2
Zinc uptake regulation protein paralog

Position: -124
Score: 5.4
Sequence: TAAATGATATGATGTATCATAAC
Position: -119
Score: 5.2
Sequence: GATATGATGTATCATAACAAATA
Locus tag: MED297_11285
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MED297_11290
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
Locus tag: MED297_11295
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: MED297_11300
Name: PF08856
Funciton: hypothetical protein
Locus tag: MED297_11305
Name: zur
Funciton: Zinc uptake regulation protein ZUR
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
yciC
Putative metal chaperone, GTPase of COG0523 family
PF08856
hypothetical protein
zur
Zinc uptake regulation protein ZUR
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD