Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Chromohalobacter salexigens DSM 3043

Properties
Regulator type: Transcription factor
TF locus tag: Csal_1882
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 6
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -70
Score: 5.3
Sequence: AGAAAGATATGTTATAACGTATT
Locus tag: Csal_0187
Name: zinT
Funciton: Candidate zinc-binding lipoprotein ZinT
zinT
Candidate zinc-binding lipoprotein ZinT

Position: -63
Score: 5.9
Sequence: TATATGTTATAACATAACTCTTT
Locus tag: Csal_0188
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -56
Score: 5.9
Sequence: AAAGAGTTATGTTATAACATATA
Locus tag: Csal_0189
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Csal_0190
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -90
Score: 5.9
Sequence: AGAATGTTATGGTATAACATATC
Locus tag: Csal_0192
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: Csal_0191
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
yciC
Putative metal chaperone, GTPase of COG0523 family
folE2
GTP cyclohydrolase I (EC 3.5.4.16) type 2
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD