Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Cellvibrio japonicus Ueda107

Properties
Regulator type: Transcription factor
TF locus tag: CJA_3482
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 5
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -3
Score: 5.4
Sequence: GTTATGTTACTCTATAACCTTTC
Locus tag: CJA_3480
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -53
Score: 5.3
Sequence: GAAAGGTTATAGAGTAACATAAC
Locus tag: CJA_3482
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: CJA_3483
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: CJA_3484
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein ZUR
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -46
Score: 6.1
Sequence: AATGTGTTATGTTATAACATATT
Locus tag: CJA_3465
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
yciC
Putative metal chaperone, GTPase of COG0523 family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD