Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Saccharophagus degradans 2-40

Properties
Regulator type: Transcription factor
TF locus tag: Sde_1974, Sde_0059
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 6
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -80
Score: 6
Sequence: GTTATGTTATCATATAACACTTT
Locus tag: Sde_0060
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -184
Score: 5.6
Sequence: ATAATGATATCATATATCATATC
Locus tag: Sde_1980
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
Locus tag: Sde_1979
Name: PF08856
Funciton: hypothetical protein
yciC
Putative metal chaperone, GTPase of COG0523 family
PF08856
hypothetical protein

Position: -51
Score: 6.1
Sequence: AAAGTGTTATATGATAACATAAC
Locus tag: Sde_0059
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: Sde_0058
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Sde_0057
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein ZUR
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD