Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Marinomonas sp. MWYL1

Properties
Regulator type: Transcription factor
TF locus tag: Mmwyl1_0292
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 7
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -40
Score: 5.9
Sequence: GTATTGTTACGTTATAACATTAA
Locus tag: Mmwyl1_1122
Name: null
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -51
Score: 5.2
Sequence: TACTTGTTATATCATAACAAAAT
Locus tag: Mmwyl1_0291
Name: null
Funciton: putative membrane protein
Locus tag: Mmwyl1_0292
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: Mmwyl1_0293
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: Mmwyl1_0294
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
putative membrane protein
zur
Zinc uptake regulation protein ZUR
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -39
Score: 6.6
Sequence: GAAATGTTATATCATAACATTTT
Locus tag: Mmwyl1_1446
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
yciC
Putative metal chaperone, GTPase of COG0523 family

Position: -23
Score: 4.6
Sequence: TTTGTAAAATGTTATAACGTAAC
Position: -18
Score: 5.8
Sequence: AAAATGTTATAACGTAACATGTT
Locus tag: Mmwyl1_0929
Name: PF08856
Funciton: hypothetical protein
PF08856
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD