Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Oceanospirillum sp. MED92

Properties
Regulator type: Transcription factor
TF locus tag: MED92_05843
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 9
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -152
Score: 5.7
Sequence: TAAATGTTATACCATAACAATAT
Position: -49
Score: 5.5
Sequence: TAATTGCTATATTATAACATTGC
Locus tag: MED92_02993
Name: pyrC2
Funciton: Dihydroorotase (EC 3.5.2.3)
Locus tag: MED92_02988
Name: can
Funciton: Carbonic anhydrase (EC 4.2.1.1)
pyrC2
Dihydroorotase (EC 3.5.2.3)
can
Carbonic anhydrase (EC 4.2.1.1)

Position: -38
Score: 5.7
Sequence: TTTGTGTTATATTGTAACTTTAA
Locus tag: MED92_05848
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -43
Score: 5.6
Sequence: TTAAAGTTACAATATAACACAAA
Locus tag: MED92_05843
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: MED92_05838
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MED92_05833
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein ZUR
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -138
Score: 5.3
Sequence: GCAATGTTATAATATAGCAATTA
Position: -35
Score: 5.9
Sequence: ATATTGTTATGGTATAACATTTA
Locus tag: MED92_02998
Name: null
Funciton: ribosomal protein, L31P family protein
ribosomal protein, L31P family protein

Position: -28
Score: 5.7
Sequence: TTGTTGTTATATTATAACTTTTA
Locus tag: MED92_15318
Name: zbp
Funciton: Predicted zinc-binding protein
zbp
Predicted zinc-binding protein

Position: -49
Score: 5.1
Sequence: TTAAAGTTATGTTATATTGTATC
Position: -44
Score: 5.7
Sequence: GTTATGTTATATTGTATCTTTTT
Locus tag: MED92_08311
Name: PF08856
Funciton: hypothetical protein
PF08856
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD