Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Oceanobacter sp. RED65

Properties
Regulator type: Transcription factor
TF locus tag: RED65_11929
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -52
Score: 5.4
Sequence: CAAAAGATATAATATATCATATC
Position: -47
Score: 5
Sequence: GATATAATATATCATATCTTTTA
Locus tag: RED65_11939
Name: PF08856
Funciton: hypothetical protein
PF08856
hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD