Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Marinobacter sp. ELB17

Properties
Regulator type: Transcription factor
TF locus tag: MELB17_01720
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 5
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -60
Score: 5.7
Sequence: GCAATGTTATAACATAACGTTCA
Locus tag: MELB17_12891
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -68
Score: 5.8
Sequence: GTTATGTAATATTATAACATTCT
Locus tag: MELB17_08596
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -102
Score: 5.5
Sequence: TGAACGTTATGTTATAACATTGC
Locus tag: MELB17_12886
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: MELB17_12881
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -34
Score: 5.9
Sequence: AAGATGTTATAACATAACTTTAC
Locus tag: MELB17_02870
Name: zbp
Funciton: Predicted zinc-binding protein
zbp
Predicted zinc-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD