Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Marinobacter aqueolei

Properties
Regulator type: Transcription factor
TF locus tag: Maqu_3775
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -48
Score: 6.3
Sequence: ATATTGTTATATTATAACGTTTC
Locus tag: Maqu_1892
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -39
Score: 5.6
Sequence: AAAATGTTATAACATATCAAATA
Locus tag: Maqu_3429
Name: zbp
Funciton: Predicted zinc-binding protein
zbp
Predicted zinc-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD