Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Hahella chejuensis KCTC 2396

Properties
Regulator type: Transcription factor
TF locus tag: HCH_01703, HCH_02947, HCH_00537
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes 16
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 51 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -211
Score: 5.7
Sequence: AAAAAGATATGATATAACGTATC
Position: -206
Score: 5.2
Sequence: GATATGATATAACGTATCTTTAT
Locus tag: HCH_01703
Name: zur2
Funciton: Zinc uptake regulation protein ZUR
Locus tag: HCH_10001
Name: hisI2
Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
Locus tag: HCH_01704
Name: pyrC2
Funciton: Dihydroorotase (EC 3.5.2.3)
Locus tag: HCH_01706
Name: folE2
Funciton: GTP cyclohydrolase I (EC 3.5.4.16) type 2
Locus tag: HCH_01707
Name: dksA2
Funciton: C4-type zinc finger protein, DksA/TraR family
zur2
Zinc uptake regulation protein ZUR
hisI2
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19)
pyrC2
Dihydroorotase (EC 3.5.2.3)
folE2
GTP cyclohydrolase I (EC 3.5.4.16) type 2
dksA2
C4-type zinc finger protein, DksA/TraR family

Position: -66
Score: 4.9
Sequence: AAAAAGATATGATGCAACATATC
Locus tag: HCH_02943
Name: null
Funciton: hypothetical protein
Locus tag: HCH_02944
Name: omr
Funciton: Zinc-regulated TonB-dependent outer membrane receptor
Locus tag: HCH_02945
Name: znuA2
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
Locus tag: HCH_02946
Name: znuB2
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
hypothetical protein
omr
Zinc-regulated TonB-dependent outer membrane receptor
znuA2
Zinc ABC transporter, periplasmic-binding protein ZnuA
znuB2
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -64
Score: 6.3
Sequence: ATAATGTTATGTTATAACCTTTC
Locus tag: HCH_02413
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -59
Score: 6.2
Sequence: GTTTTGTTATGTTATAACATTTT
Locus tag: HCH_02800
Name: yciC
Funciton: Putative metal chaperone, GTPase of COG0523 family
yciC
Putative metal chaperone, GTPase of COG0523 family

Position: -84
Score: 6.3
Sequence: GATATGTTACATCATAACATTTT
Locus tag: HCH_02942
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -80
Score: 5.3
Sequence: CAATTGTTATAACATTACACTTC
Locus tag: HCH_00537
Name: zur
Funciton: Zinc uptake regulation protein ZUR
Locus tag: HCH_00536
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
Locus tag: HCH_00535
Name: znuB
Funciton: Zinc ABC transporter, inner membrane permease protein ZnuB
zur
Zinc uptake regulation protein ZUR
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
znuB
Zinc ABC transporter, inner membrane permease protein ZnuB

Position: -70
Score: 5.7
Sequence: GTTTCGTTATGTTATAACATAAA
Locus tag: HCH_00656
Name: zbp
Funciton: Predicted zinc-binding protein
zbp
Predicted zinc-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD