Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Aeromonas salmonicida subsp. salmonicida A449

Properties
Regulator type: Transcription factor
TF locus tag: ASA_3640
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 4
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -42
Score: 6.4
Sequence: TAATTGTTATAAGATAACATATC
Locus tag: ASA_2374
Name: rpmE
Funciton: LSU ribosomal protein L31p
Locus tag: ASA_2375
Name: rpmJ
Funciton: 50S ribosomal protein L36
rpmE
LSU ribosomal protein L31p
rpmJ
50S ribosomal protein L36

Position: 26
Score: 6.2
Sequence: TGAGAGTTATAATATAACAGCAG
Locus tag: ASA_0558
Name: znuA
Funciton: Zinc ABC transporter, periplasmic-binding protein ZnuA
znuA
Zinc ABC transporter, periplasmic-binding protein ZnuA

Position: -74
Score: 6.5
Sequence: AGTGTGTGATAATATAACAAACC
Locus tag: ASA_0557
Name: znuC
Funciton: Zinc ABC transporter, ATP-binding protein ZnuC
znuC
Zinc ABC transporter, ATP-binding protein ZnuC
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD