Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Psychromonas sp. CNPT3

Properties
Regulator type: Transcription factor
TF locus tag: PCNPT3_12907
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -55
Score: 5
Sequence: TTTTTGTTATATTATAACACTTT
Locus tag: PCNPT3_01665
Name: zip
Funciton: Predicted zinc transporter, ZIP family
zip
Predicted zinc transporter, ZIP family

Position: -37
Score: 7.1
Sequence: TAAGTGTTATGTTATAACATAAC
Locus tag: PCNPT3_03847
Name: rpmE
Funciton: LSU ribosomal protein L31p
Locus tag: PCNPT3_03852
Name: rpmJ
Funciton: 50S ribosomal protein L36
rpmE
LSU ribosomal protein L31p
rpmJ
50S ribosomal protein L36
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD