Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Psychromonas ingrahamii 37

Properties
Regulator type: Transcription factor
TF locus tag: Ping_3179
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -91
Score: 6
Sequence: TAAGTGTTATATTATAACACTTA
Position: -52
Score: 6.6
Sequence: TAAGTGTTATAATATAACAAAAT
Locus tag: Ping_3634
Name: zip
Funciton: Predicted zinc transporter, ZIP family
zip
Predicted zinc transporter, ZIP family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD