Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Idiomarina baltica OS145

Properties
Regulator type: Transcription factor
TF locus tag: OS145_05740
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Alteromonadales
Statistics of regulated genes:
- Genes 2
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 46 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -67
Score: 6.5
Sequence: GTAATGTTATATTATCACATTAA
Locus tag: OS145_12066
Name: omr
Funciton: Zinc-regulated outer membrane receptor
omr
Zinc-regulated outer membrane receptor

Position: -43
Score: 5.7
Sequence: CGTATGTTATAATATAACAGGCT
Locus tag: OS145_08107
Name: PF03203
Funciton: MerC-like membrane protein
PF03203
MerC-like membrane protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD