Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Pseudoalteromonas tunicata D2

Properties
Regulator type: Transcription factor
TF locus tag: PTD2_07999
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Alteromonadales
Statistics of regulated genes:
- Genes 6
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 46 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 5.8
Sequence: CTTTTGATATATTATCACATAAC
Locus tag: PTD2_00701
Name: PF08856
Funciton: hypothetical protein
PF08856
hypothetical protein

Position: -34
Score: 5.7
Sequence: GTTATGATATACTATCACATAAT
Locus tag: PTD2_02796
Name: rpmE2
Funciton: LSU ribosomal protein L31p
Locus tag: PTD2_02801
Name: rpmJ
Funciton: LSU ribosomal protein L36p
rpmE2
LSU ribosomal protein L31p
rpmJ
LSU ribosomal protein L36p

Position: -83
Score: 5.6
Sequence: CAAATGTTATAGCATCACAGTTG
Position: -43
Score: 5
Sequence: GTAATGTTACACTATCTCAATTG
Locus tag: PTD2_19912
Name: omr
Funciton: Zinc-regulated outer membrane receptor
omr
Zinc-regulated outer membrane receptor

Position: -47
Score: 6
Sequence: CTTTTGTTATATTATCACAATAT
Locus tag: PTD2_14447
Name: ribA
Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
Locus tag: PTD2_14452
Name: ribA
Funciton: GTP cyclohydrolase II (EC 3.5.4.25)
ribA
GTP cyclohydrolase II (EC 3.5.4.25)
ribA
GTP cyclohydrolase II (EC 3.5.4.25)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD