Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Zur in Colwellia psychrerythraea 34H

Properties
Regulator type: Transcription factor
TF locus tag: CPS_0412
Regulator family: FUR
Regulation mode: repressor
Biological process: Zinc homeostasis
Effector: Zinc ion, (Zn2+)
Regulog: Zur - Alteromonadales
Statistics of regulated genes:
- Genes 4
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 46 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -60
Score: 5.9
Sequence: TTTATGTTATGTTATAACATTGA
Locus tag: CPS_1814
Name: PF11736
Funciton: lipoprotein, putative
PF11736
lipoprotein, putative

Position: -191
Score: 5.3
Sequence: TACTTGTTATAGTATAACACTTA
Locus tag: CPS_4490
Name: PF11751
Funciton: Putative exported protein
PF11751
Putative exported protein

Position: -194
Score: 6.4
Sequence: ATAATGTGATAATATAACATTAT
Position: -169
Score: 5.5
Sequence: AAATTGTTACATTATCACATTGG
Locus tag: CPS_1902
Name: omr1
Funciton: Zinc-regulated outer membrane receptor
omr1
Zinc-regulated outer membrane receptor

Position: -94
Score: 6
Sequence: CTAATGTTATATTATATCAATTG
Locus tag: CPS_0396
Name: PF03203
Funciton: MerC-like membrane protein
PF03203
MerC-like membrane protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD